View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0158_low_19 (Length: 226)
Name: NF0158_low_19
Description: NF0158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0158_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 95 - 209
Target Start/End: Original strand, 13885968 - 13886082
Alignment:
| Q |
95 |
tttacgagttcaaataatttatgagttgaacaaaatacaaattatttaggaaaagttgagttcaatttcagactttacttatcttttgcgaacttcaaat |
194 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
13885968 |
tttacgagttcaaatagtttatgagttgaacaaaataaaaattatttaggaaaagttgagttcaatttcagactttacttatctttcgcaaacttcaaat |
13886067 |
T |
 |
| Q |
195 |
tactagtattaccca |
209 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
13886068 |
tactagtattaccca |
13886082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University