View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0158_low_19 (Length: 226)

Name: NF0158_low_19
Description: NF0158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0158_low_19
NF0158_low_19
[»] chr1 (1 HSPs)
chr1 (95-209)||(13885968-13886082)


Alignment Details
Target: chr1 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 95 - 209
Target Start/End: Original strand, 13885968 - 13886082
Alignment:
95 tttacgagttcaaataatttatgagttgaacaaaatacaaattatttaggaaaagttgagttcaatttcagactttacttatcttttgcgaacttcaaat 194  Q
    |||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||    
13885968 tttacgagttcaaatagtttatgagttgaacaaaataaaaattatttaggaaaagttgagttcaatttcagactttacttatctttcgcaaacttcaaat 13886067  T
195 tactagtattaccca 209  Q
    |||||||||||||||    
13886068 tactagtattaccca 13886082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University