View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0158_low_22 (Length: 205)

Name: NF0158_low_22
Description: NF0158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0158_low_22
NF0158_low_22
[»] chr8 (1 HSPs)
chr8 (15-100)||(39669959-39670044)


Alignment Details
Target: chr8 (Bit Score: 82; Significance: 6e-39; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 82; E-Value: 6e-39
Query Start/End: Original strand, 15 - 100
Target Start/End: Original strand, 39669959 - 39670044
Alignment:
15 gacatgtcggagtcagcgggagcgtaggatgaggaacagcccgagtaacgaggaacacaacaaagaccaaaaccaagtagtggtag 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
39669959 gacatgtcggagtcagcgggagcgtaggatgaggaacagcccgagtaacgaggaacacaacaaagaccaaaaccaagtagtagtag 39670044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University