View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0159_low_4 (Length: 247)
Name: NF0159_low_4
Description: NF0159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0159_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 15 - 154
Target Start/End: Original strand, 40284916 - 40285055
Alignment:
| Q |
15 |
taaatataaaacattttctgtcaccatgcttgcaacaaatagcaagttaaccaagttacaatttaaaaaatattcaaactccttcctaaagaatataggc |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40284916 |
taaatataaaacattttctgtcaccatgcttgcaacaaatagcaagttaaccaagttacaatttaaaaaatattcaatctccttcctaaagaatataggc |
40285015 |
T |
 |
| Q |
115 |
ataagcacaaaaaatggccaaaaataaatttgctgatgat |
154 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40285016 |
ataagcacaaaaaatgtccaaaaataaatttgctgatgat |
40285055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University