View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0159_low_5 (Length: 246)
Name: NF0159_low_5
Description: NF0159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0159_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 10 - 147
Target Start/End: Complemental strand, 40284897 - 40284760
Alignment:
| Q |
10 |
taagataagcatgtcatctgcgtttttaggtcaagatcatgggtaatgttcgtctattgctccatccttgtacctaatatggtttttagaaagtttgatc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
40284897 |
taagataagcatgtcatctgcgtttttaggtcaagatcataggtaatgttcgtctattgctccatccttgtaccttacatggtttttagaaagtttgatc |
40284798 |
T |
 |
| Q |
110 |
acaccaaagagaatacaaagccaggtaaagggtgaggt |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40284797 |
acaccaaagagaatacaaagccaggtaaagggtgaggt |
40284760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University