View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0160-INSERTION-11 (Length: 103)
Name: NF0160-INSERTION-11
Description: NF0160
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0160-INSERTION-11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 81; Significance: 1e-38; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 81; E-Value: 1e-38
Query Start/End: Original strand, 8 - 92
Target Start/End: Complemental strand, 45138481 - 45138397
Alignment:
Q |
8 |
tatcaatgggctactcttctcaagaccatgagaacaaatggtctcgtattttatcatatagataggatatcattgtttttgtcac |
92 |
Q |
|
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45138481 |
tatcaatgggctactcttctcaagaccatgcgaacaaatggtctcgtattttatcatatagataggatatcattgtttttgtcac |
45138397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University