View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0160_high_4 (Length: 308)

Name: NF0160_high_4
Description: NF0160
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0160_high_4
NF0160_high_4
[»] chr8 (1 HSPs)
chr8 (142-308)||(3323356-3323531)


Alignment Details
Target: chr8 (Bit Score: 95; Significance: 2e-46; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 142 - 308
Target Start/End: Original strand, 3323356 - 3323531
Alignment:
142 gcgaggtcaaatcccgcgtacagacaggaggttaaaataggtaaaccaatccatcaccnnnnnnncaccacaaacaaaacag---------gaggacaac 232  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||         |||||||||    
3323356 gcgaggtcaaatcccacgtacagacaggaggttaaaataggtaaaccaatccatcaccataaaaacaccacaaacaaaacagataaaataggaggacaac 3323455  T
233 aacaggaacacccagagggtttatgctcattgctgattgtgattcctacctgtaaagttttctgcaatttgtattc 308  Q
    |||||||||||||||||||||||||||||||||| ||| |||||||||| ||||| | ||| ||||||||||||||    
3323456 aacaggaacacccagagggtttatgctcattgctcattatgattcctacatgtaacggtttatgcaatttgtattc 3323531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 556 times since January 2019
Visitors: 2229