View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0160_high_4 (Length: 308)
Name: NF0160_high_4
Description: NF0160
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0160_high_4 |
 |  |
|
[»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 95; Significance: 2e-46; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 142 - 308
Target Start/End: Original strand, 3323356 - 3323531
Alignment:
Q |
142 |
gcgaggtcaaatcccgcgtacagacaggaggttaaaataggtaaaccaatccatcaccnnnnnnncaccacaaacaaaacag---------gaggacaac |
232 |
Q |
|
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||| |
|
|
T |
3323356 |
gcgaggtcaaatcccacgtacagacaggaggttaaaataggtaaaccaatccatcaccataaaaacaccacaaacaaaacagataaaataggaggacaac |
3323455 |
T |
 |
Q |
233 |
aacaggaacacccagagggtttatgctcattgctgattgtgattcctacctgtaaagttttctgcaatttgtattc |
308 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||| |||||||||| ||||| | ||| |||||||||||||| |
|
|
T |
3323456 |
aacaggaacacccagagggtttatgctcattgctcattatgattcctacatgtaacggtttatgcaatttgtattc |
3323531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 556 times since January 2019
Visitors: 2229