View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0161_low_4 (Length: 252)
Name: NF0161_low_4
Description: NF0161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0161_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 1e-53; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 8 - 170
Target Start/End: Complemental strand, 47893060 - 47892898
Alignment:
Q |
8 |
ctgagtgtgcttatgttttgttgcgtggcttttgtttgaatgataacatattgtatcactacttggttcggttgacactaggaaaatagacaacaataat |
107 |
Q |
|
|
|||||||||||||||| | ||||| ||||||||||||||||||||| ||| |||||||||||||| |||||||||||||||||||||||||||||| || |
|
|
T |
47893060 |
ctgagtgtgcttatgtctcgttgcatggcttttgtttgaatgataatatactgtatcactacttgcttcggttgacactaggaaaatagacaacaaccat |
47892961 |
T |
 |
Q |
108 |
tccgtgtattttatggttagatatgcatatgtttagtttaattaacgagtaaatacccaagtt |
170 |
Q |
|
|
||| ||||||||||||||||||||||||||| ||| | |||||| ||||||||||||||||| |
|
|
T |
47892960 |
tccttgtattttatggttagatatgcatatgattactgtaattagtgagtaaatacccaagtt |
47892898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 1 - 120
Target Start/End: Original strand, 50681187 - 50681311
Alignment:
Q |
1 |
catgttcctgagtgtgcttatgttttgttgcgtggcttttgtttgaatgataacatattgtatcactacttggttcggtt-----gacactaggaaaata |
95 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| | ||||||||||||||| |
|
|
T |
50681187 |
catgttcctgagtgtgcttatgttttgttgcgtggcttttgtttgaatgataacatattgtatcactgcttggttcggctcggctgacactaggaaaata |
50681286 |
T |
 |
Q |
96 |
gacaacaataattccgtgtatttta |
120 |
Q |
|
|
|||||||||||||| |||| |||| |
|
|
T |
50681287 |
aacaacaataattccttgtagttta |
50681311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 141 - 238
Target Start/End: Original strand, 50681305 - 50681408
Alignment:
Q |
141 |
tagtttaattaacgagtaaatacccaagttccagaactaattagggtattatttgagg------gttgttgttgttgggataggtttgtatttgttgatg |
234 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
T |
50681305 |
tagtttaattaacgagtaaatacccaagttccagaactaattagggtattatttgagggttgttgttgttgttgttgtgataggtttgtatttgttgatg |
50681404 |
T |
 |
Q |
235 |
atgt |
238 |
Q |
|
|
|||| |
|
|
T |
50681405 |
atgt |
50681408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 636 times since January 2019
Visitors: 2235