View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0161_low_5 (Length: 217)
Name: NF0161_low_5
Description: NF0161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0161_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 16 - 194
Target Start/End: Original strand, 34675188 - 34675366
Alignment:
| Q |
16 |
catcatcaagctcatacaattcaccatgtgcagcctgcaaattccttcgtcgaaaatgcatgccaggctgcatctttgcaccatactttccaccggaaga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34675188 |
catcatcaagctcatacaattcaccatgtgcagcctgcaaattccttcgtcgaaaatgcatgccaggctgcatctttgcaccatactttccaccggaaga |
34675287 |
T |
|
| Q |
116 |
gcctcaaaaatttgcaaacgttcacaagatcttcggcgcaagcaacgtcacaaagaccctcaacgaactcctccctcac |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34675288 |
acctcaaaaatttgcaaacgttcacaagatcttcggcgcaagcaacgtcacaaagatcctcaacgaactcctccctcac |
34675366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 79; Significance: 4e-37; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 16 - 194
Target Start/End: Original strand, 43583177 - 43583355
Alignment:
| Q |
16 |
catcatcaagctcatacaattcaccatgtgcagcctgcaaattccttcgtcgaaaatgcatgccaggctgcatctttgcaccatactttccaccggaaga |
115 |
Q |
| |
|
||||||| ||||||||||||||||| ||||| |||||||||||| | | |||||||||||||||| |||||||||||||| ||||| || || ||||| |
|
|
| T |
43583177 |
catcatccagctcatacaattcaccttgtgctgcctgcaaattcttgaggagaaaatgcatgccaggatgcatctttgcaccttacttccctccagaaga |
43583276 |
T |
|
| Q |
116 |
gcctcaaaaatttgcaaacgttcacaagatcttcggcgcaagcaacgtcacaaagaccctcaacgaactcctccctcac |
194 |
Q |
| |
|
||||||||||||||||||||| ||||| || || || || ||||| ||||||||| ||||| ||||| ||||||||| |
|
|
| T |
43583277 |
gcctcaaaaatttgcaaacgtgcacaaaatatttggtgctagcaatgtcacaaagcttctcaatgaacttctccctcac |
43583355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 72 - 160
Target Start/End: Complemental strand, 12360861 - 12360773
Alignment:
| Q |
72 |
tgcatgccaggctgcatctttgcaccatactttccaccggaagagcctcaaaaatttgcaaacgttcacaagatcttcggcgcaagcaa |
160 |
Q |
| |
|
|||||||||| ||||| ||||| ||||| || ||||| ||||| || |||||||||||||| |||||||| || || || |||||||| |
|
|
| T |
12360861 |
tgcatgccagattgcatatttgctccatatttcccaccagaagaaccacaaaaatttgcaaatgttcacaaaatatttggtgcaagcaa |
12360773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 652 times since January 2019
Visitors: 2235