View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0162_low_2 (Length: 254)
Name: NF0162_low_2
Description: NF0162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0162_low_2 |
 |  |
|
[»] scaffold0092 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0092 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: scaffold0092
Description:
Target: scaffold0092; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 5 - 233
Target Start/End: Original strand, 22388 - 22616
Alignment:
Q |
5 |
gagcagcagagacaaaaattcaaagtcatgtacaagaggaagctatatcctcatggaaagtttgggaacctcctgatccaacaaggaggtccatgaaaac |
104 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
22388 |
gagcatcagagacaaaaattcaaagtcatgtacaagaggaagctatatcctcatggaaagtttgggaacctcctgatcgaacaaggaggtccatgaaaac |
22487 |
T |
 |
Q |
105 |
caggtgataaatagaggatgtttatttac-cnnnnnnnnnaggatttcttgctatgaaactatgtgattggtctaggtcaaactatttacattttatata |
203 |
Q |
|
|
||||||| ||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
22488 |
caggtgaaaaatagaggatgttt-tttactttttttttttaggatttcttgctatgaaactatgtgattggtctaggtccaactatttacattttatata |
22586 |
T |
 |
Q |
204 |
gggattttatttaccatcactatgatgatg |
233 |
Q |
|
|
|||||||||||||||||||||||||||||| |
|
|
T |
22587 |
gggattttatttaccatcactatgatgatg |
22616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1482 times since January 2019
Visitors: 2192