View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0163_high_6 (Length: 251)
Name: NF0163_high_6
Description: NF0163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0163_high_6 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 30 - 251
Target Start/End: Complemental strand, 998725 - 998504
Alignment:
| Q |
30 |
ggaagatcactcaaaagtggagtcacttggggagtttttccagaagatcttaaagagtcacagaaaaaagtatttgatcctcaagataagaatcgtcttt |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
998725 |
ggaagatcactcaaaagtggagtcacttggggagtttttccagaagatcttaaagtgtcacagaaaaaagtatttgatcctcaagataagaatcttcttt |
998626 |
T |
|
| Q |
130 |
attggaacaagtttttcgagattctatgcatcctttctgtagcttgtgatcctttcnnnnnnnctcttccttatttcaaccacaaatcatattgtttagc |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
998625 |
attggaacaagtttttcgagattctatgcatcctttctgtagcttgtgatcctttctttttttatcttccttatttcaaccacaaatcatattgtttagc |
998526 |
T |
|
| Q |
230 |
catagataacgatctagagaag |
251 |
Q |
| |
|
|||||||||| |||||| |||| |
|
|
| T |
998525 |
catagataacaatctagcgaag |
998504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1097 times since January 2019
Visitors: 2243