View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0163_high_9 (Length: 201)
Name: NF0163_high_9
Description: NF0163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0163_high_9 |
 |  |
|
| [»] scaffold0505 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 73; Significance: 1e-33; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 73; E-Value: 1e-33
Query Start/End: Original strand, 9 - 93
Target Start/End: Original strand, 4892748 - 4892832
Alignment:
| Q |
9 |
cgaaattataccttttctttcccttcgatctgcgacgcggtgattatgatcctggtccgttttcgtgatgcttgcttctcgcgtc |
93 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4892748 |
cgaaattataccttttctttctcttcgatctgcgacgcggtgcttataatcctggtccgttttcgtgatgcttgcttctcgcgtc |
4892832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 9 - 70
Target Start/End: Complemental strand, 12662816 - 12662755
Alignment:
| Q |
9 |
cgaaattataccttttctttcccttcgatctgcgacgcggtgattatgatcctggtccgttt |
70 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||| |||| ||||||| ||||||||||| |
|
|
| T |
12662816 |
cgaagttataccttttctttctcttcgatctgcgacgaggtggttatgattctggtccgttt |
12662755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0505 (Bit Score: 72; Significance: 6e-33; HSPs: 1)
Name: scaffold0505
Description:
Target: scaffold0505; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 12393 - 12298
Alignment:
| Q |
1 |
aagtggcacgaaattataccttttctttcccttcgatctgcgacgcggtgattatgatcctggtccgttttcgtgatgcttgcttctcgcgtccga |
96 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||||||||||||||||| |||| |||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
12393 |
aagtgacacgaaattataccttttctttctcttcgatctgcgacgcggtgcttataatcctggtccgttttcgtgaagcttgcttctcgcatccga |
12298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 72; Significance: 6e-33; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 13087477 - 13087382
Alignment:
| Q |
1 |
aagtggcacgaaattataccttttctttcccttcgatctgcgacgcggtgattatgatcctggtccgttttcgtgatgcttgcttctcgcgtccga |
96 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||||||||||||||||| |||| |||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
13087477 |
aagtgacacgaaattataccttttctttctcttcgatctgcgacgcggtgcttataatcctggtccgttttcgtgaagcttgcttctcgcatccga |
13087382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 7 - 70
Target Start/End: Original strand, 30067844 - 30067907
Alignment:
| Q |
7 |
cacgaaattataccttttctttcccttcgatctgcgacgcggtgattatgatcctggtccgttt |
70 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||| |||| ||||||| ||||||||||| |
|
|
| T |
30067844 |
cacgaaattatacctttcctttctcttcgatctgcgacgaggtggttatgattctggtccgttt |
30067907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University