View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0163_low_4 (Length: 280)
Name: NF0163_low_4
Description: NF0163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0163_low_4 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 1 - 280
Target Start/End: Complemental strand, 998888 - 998609
Alignment:
Q |
1 |
tttggattccaattcgtcaatgccatctagctcaagtgggatgaagaagttaagatttaatttagattgtttgccttttcttattcccggtcgcgggnnn |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
998888 |
tttggattccaattcgtcaatgccatctagctcaagtgggatgaagaagttaagatttaatttagattgtttgccttttcttattcccggtcgcgggaaa |
998789 |
T |
 |
Q |
101 |
nnnnnttcgtcgaaatcgtttcgagtcggagtgaaaaagggatcagatggactaatgaatattggaagatcactcaaaagtggagtcacttggggagttt |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
998788 |
aaaaattcgtcgaaatcgtttcgagtcggagtgaaaaagggatcagatggactaatgaatattggaagatcactcaaaagtggagtcacttggggagttt |
998689 |
T |
 |
Q |
201 |
ttccagaagatcttaaagtgtcacagaaaaaagtatttgatcctcaagataagaatcttctttattggaacaagtttttc |
280 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
998688 |
ttccagaagatcttaaagtgtcacagaaaaaagtatttgatcctcaagataagaatcttctttattggaacaagtttttc |
998609 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University