View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0165_low_6 (Length: 275)
Name: NF0165_low_6
Description: NF0165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0165_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 1 - 252
Target Start/End: Complemental strand, 33282446 - 33282179
Alignment:
| Q |
1 |
gattacagggtgcaaaaacatgttagactcgataagggaggaaaggaaatgagatttatcatttagtaaagaaatatctagagtttttccttttcataat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33282446 |
gattacagggtgcaaaaacatgttagactccataagggaggaaaggaactgagatttatcatttagtaaagaaatatctagagtttttccttttcataat |
33282347 |
T |
|
| Q |
101 |
gttgcatgaacttta--------------ag---gcatagaaaaatgtcaacaatttaaggcatctccatcaggggacaccggaagcataactgggtctg |
183 |
Q |
| |
|
||||||||||||||| || |||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33282346 |
gttgcatgaactttatatggggcaacactagtgagcatagaaaa-tgtcaacaatttaaggcatctccatcagggaacaccggaagcataactgggtctg |
33282248 |
T |
|
| Q |
184 |
tctgcttaggcacctctaactcaatgtcgatgggtcatattttaccatcaatggaagctcgactgatga |
252 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33282247 |
tctgcttaggcacctcgaactcaatgtcgatgggtcatattttaccatcaatggaagctcgactaatga |
33282179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 191 - 242
Target Start/End: Complemental strand, 7701771 - 7701720
Alignment:
| Q |
191 |
aggcacctctaactcaatgtcgatgggtcatattttaccatcaatggaagct |
242 |
Q |
| |
|
|||| |||| |||||||||||||||||||| |||||| || ||||||||||| |
|
|
| T |
7701771 |
aggcgcctcaaactcaatgtcgatgggtcacattttatcagcaatggaagct |
7701720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University