View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0165_low_7 (Length: 274)
Name: NF0165_low_7
Description: NF0165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0165_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 33282422 - 33282647
Alignment:
Q |
1 |
taacatgtttttgcaccctgtaatcatgacaagagaaaccatttgaaataatctctccaatctgaatacaaaagaaatcaaataaggagaaagggagcca |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
33282422 |
taacatgtttttgcaccctgtaatcatgacaagagaaaccatttgaaataatatctccaatctcaatacaaaagaaatcaaataaggagaaagggagcca |
33282521 |
T |
 |
Q |
101 |
cattttctca-----ggaaagtagtaaannnnnnnaagattttgccattccacaacatatggattttagaggaagaaatgcaaatgacatcaaccaactt |
195 |
Q |
|
|
|||||||| | ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33282522 |
cattttcttatactttcaaagtagtaaattcttttaagattttgccattccacaacatatggattttagaggaagaaatgcaaatgacatcaaccaactt |
33282621 |
T |
 |
Q |
196 |
ctggccggggaaacacaatgccataa |
221 |
Q |
|
|
|||||||||||||||| ||||||||| |
|
|
T |
33282622 |
ctggccggggaaacacgatgccataa |
33282647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University