View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0166_high_6 (Length: 240)
Name: NF0166_high_6
Description: NF0166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0166_high_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 31750316 - 31750540
Alignment:
| Q |
1 |
taattagaaaagataaatatttcaattattttaagggtaaaaataaatatttcatgttttagtagaaaactgaatggtttatctcaatgtgtgatgttca |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
31750316 |
taattagaaaaaataaatatttcaattattttaagggtaaaaataaatatttcattttttagtagaaaactaaatggtttatctcaatgtgtgatgttca |
31750415 |
T |
|
| Q |
101 |
tattggcgaagctcttagtctactattagcattaggacggattcatgaattaagttgggacacttaattttgagatttattctaaaagagttgttgataa |
200 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31750416 |
tattggtgaagctcttagtctgctattagcattaggacgggttcatgaattaagttgggacacttaattttgagatttattctaaaagagttgttgataa |
31750515 |
T |
|
| Q |
201 |
tcttttatcccaaaacatgatgatg |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
31750516 |
tcttttatcccaaaacatgatgatg |
31750540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 66 - 222
Target Start/End: Complemental strand, 17093200 - 17093042
Alignment:
| Q |
66 |
aaaactgaatggtttatctcaatgtgtgatgttcatattggcgaagctcttagtctactattagcattaggacggattcatgaatta-agttgggacac- |
163 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||||| ||||||| | ||||| ||| | | |||||| || ||||||| || ||||||||| | |
|
|
| T |
17093200 |
aaaagtgaatggtttagtccaatgtgtgatgttcatattggtgaagctcgtggtctattatcatctttaggatgggttcatgagctagagttgggacccg |
17093101 |
T |
|
| Q |
164 |
ttaattttgagatttattctaaaagagttgttgataatcttttatcccaaaacatgatg |
222 |
Q |
| |
|
| ||||||||| | ||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
17093100 |
tcaattttgagctcgattctaaaagagttgttgatagatttttatccccaaacatgatg |
17093042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1080 times since January 2019
Visitors: 1523