View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0169-INSERTION2 (Length: 237)
Name: NF0169-INSERTION2
Description: NF0169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0169-INSERTION2 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 8 - 205
Target Start/End: Complemental strand, 3235353 - 3235160
Alignment:
Q |
8 |
gatagcactattgttgtcaatatgtttgaagttttgctggtgtttaagtaagtaagtatgaaccaacaagcaacctttcctgtactctttggtcgatttg |
107 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3235353 |
gatagcactattgttgtcaatatgtttgaagttttgctggtgtttaagtaagta----tgaaccaacaagcaacctttcctgtactctttggtcgatttg |
3235258 |
T |
 |
Q |
108 |
gaaacaaagaaaatgtttgtatttggaagtatgtcacatacttactaacaagatggcaaaatgctaggatcagccacatgttagtagaagatggaaag |
205 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
3235257 |
gaaacaaagaaaatgtttgtatttggaactatgtcacatatttactaacaagatggcaaaatgctaggatcagccacatgtaagtagaagatggaaag |
3235160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 513 times since January 2019
Visitors: 2226