View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0169-INSERTION3 (Length: 152)
Name: NF0169-INSERTION3
Description: NF0169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0169-INSERTION3 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 142; Significance: 7e-75; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 7e-75
Query Start/End: Original strand, 11 - 152
Target Start/End: Original strand, 41491530 - 41491671
Alignment:
| Q |
11 |
atatcattcttagtttctgctattactcttgcaggtcaacacttcacagggtgatgccaacaggaaaagaacgctactctgtaactattactaaccactt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41491530 |
atatcattcttagtttctgctattactcttgcaggtcaacacttcacagggtgatgccaacaggaaaagaacgctactctgtaactattactaaccactt |
41491629 |
T |
 |
| Q |
111 |
ctttctagccatgacattacacatttcgcttctttgttttca |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41491630 |
ctttctagccatgacattacacatttcgcttctttgttttca |
41491671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 1e-20
Query Start/End: Original strand, 32 - 94
Target Start/End: Original strand, 41483665 - 41483727
Alignment:
| Q |
32 |
attactcttgcaggtcaacacttcacagggtgatgccaacaggaaaagaacgctactctgtaa |
94 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
41483665 |
attactcttgcaggtcaacccttcacagggtgatgccaaccggaaaagaacgctattctgtaa |
41483727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University