View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0169-INSERTION3 (Length: 152)

Name: NF0169-INSERTION3
Description: NF0169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0169-INSERTION3
NF0169-INSERTION3
[»] chr4 (2 HSPs)
chr4 (11-152)||(41491530-41491671)
chr4 (32-94)||(41483665-41483727)


Alignment Details
Target: chr4 (Bit Score: 142; Significance: 7e-75; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 142; E-Value: 7e-75
Query Start/End: Original strand, 11 - 152
Target Start/End: Original strand, 41491530 - 41491671
Alignment:
Q  11 atatcattcttagtttctgctattactcttgcaggtcaacacttcacagggtgatgccaacaggaaaagaacgctactctgtaactattactaaccactt 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41491530 atatcattcttagtttctgctattactcttgcaggtcaacacttcacagggtgatgccaacaggaaaagaacgctactctgtaactattactaaccactt 41491629  T
Q  111 ctttctagccatgacattacacatttcgcttctttgttttca 152  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  41491630 ctttctagccatgacattacacatttcgcttctttgttttca 41491671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 51; E-Value: 1e-20
Query Start/End: Original strand, 32 - 94
Target Start/End: Original strand, 41483665 - 41483727
Alignment:
Q  32 attactcttgcaggtcaacacttcacagggtgatgccaacaggaaaagaacgctactctgtaa 94  Q
    ||||||||||||||||||| |||||||||||||||||||| |||||||||||||| |||||||    
T  41483665 attactcttgcaggtcaacccttcacagggtgatgccaaccggaaaagaacgctattctgtaa 41483727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 4866 times since January 2019
Visitors: 7537