View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0169-INSERTION5 (Length: 365)
Name: NF0169-INSERTION5
Description: NF0169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0169-INSERTION5 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 325; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 37 - 365
Target Start/End: Original strand, 38508559 - 38508887
Alignment:
Q |
37 |
acaaatcaaatcaaagtgataaaggttaaatctcactagatcatggcaaacacttataatacctcgtcacatattagtcaaacaaattcccaagtgcatt |
136 |
Q |
|
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38508559 |
acaaatcaaatcaaagtgataaaggtcaaatctcactagatcatggcaaacacttataatacctcgtcacatattagtcaaacaaattcccaagtgcatt |
38508658 |
T |
 |
Q |
137 |
tatctttccacatgcaattggcaacatctccttttgattttgattttgttgcctttgaggaatatcttggtaagatgacatagttgattcatcacttcct |
236 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38508659 |
tatctttccacatgcaattggcaacatctccttttgattttgattttgttgcctttgaggaatatcttggtaagatgacatagttgattcatcacttcct |
38508758 |
T |
 |
Q |
237 |
tcaatcactccttgctttctcatatattccaatttgtcttggaagagataaatcaatccaatgaaaaagacttccaccgtaaaaagtatagtccaaaaca |
336 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38508759 |
tcaatcactccttgctttctcatatattccaatttgtcttggaagagataaatcaatccaatgaaaaagacttccaccgtaaaaagtatagtccaaaaca |
38508858 |
T |
 |
Q |
337 |
ttgtgctttttaaggttctcttgtgatat |
365 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
38508859 |
ttgtgctttttaaggttctcttgtgatat |
38508887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 515 times since January 2019
Visitors: 2226