View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0169_high_16 (Length: 243)
Name: NF0169_high_16
Description: NF0169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0169_high_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 49819516 - 49819289
Alignment:
| Q |
1 |
aaaggataaagaaacttctaattgttacagtacaaatttctctacatggtctttcttggcccgtgtgatcccgaagttcgtgatgcactattttcatttc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49819516 |
aaaggataaagaaacttctaattgttacagtacaaatttctcttcatggtctttcttggctcgtgtgatcccgaagttcgtgatgcactattttcatttc |
49819417 |
T |
|
| Q |
101 |
attgagcctttagcaacaagtctcgttcttgaattatgtctttgaaggagcgacttagctccattagtaatgtaatggcacctcatttgtttcatcctac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49819416 |
attgagcctttagcaacaagtctcgttcttgaattatgtctttgaaggagcgacttagctccattagtaatgtaatggcacctcatttgtttcatcctac |
49819317 |
T |
|
| Q |
201 |
ctttaatccatcaagtccgttgatgatg |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
49819316 |
ctttaatccatcaagtccgttgatgatg |
49819289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1129 times since January 2019
Visitors: 2244