View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0169_low_1 (Length: 543)
Name: NF0169_low_1
Description: NF0169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0169_low_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 420; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 420; E-Value: 0
Query Start/End: Original strand, 22 - 453
Target Start/End: Original strand, 36534304 - 36534735
Alignment:
| Q |
22 |
catcatcagttttttcaacgtatcgagtctgaattgaatgatcatcgtgtttctcggacctaggagtattttgttcaacccttcacaaagcataatttat |
121 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36534304 |
catcctcagttttttcaacgtatcgagtctggattgaatgatcatcgtgtttctcggacctaggagtattttgttcaacccttcacaaagcataatttat |
36534403 |
T |
|
| Q |
122 |
tgacaaacatcagacttgggttaccactggagccatctagaatatcagataaaacaaaaaacaagttcttacctatttgaattaccaacaacgtcatagt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36534404 |
tgacaaacatcagacttgggttaccactggagccatctagaatatcagataaaacaaaaaacaagttcttacctatttgaattaccaacaacgtcatagt |
36534503 |
T |
|
| Q |
222 |
tttttattgcaacatcatcaacccctcgctccttcaaaacctgatggaaagatgaaaataagatttagtaatgctagttgctgcatttagaactatgaga |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36534504 |
tttttattgcaacatcatcaacccctcgctccttcaaaacctgatggaaagatgaaaataagatttagtaatgctagttgctgcatttagaactatgaga |
36534603 |
T |
|
| Q |
322 |
cctttcaaaccacataaattgtgggggtgggggaattccactaaagagaggataaacattttaagaagacataaaatgaacacgtgtgaaacaactatcc |
421 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36534604 |
cctttcaaaccacataaattgtgggggtgggggaattccactaaagagaggataaacattttaagaagacataaaatgaacacgtgtgaaacaactatcc |
36534703 |
T |
|
| Q |
422 |
ctgctcacgacagtcaaaagatagaggttgga |
453 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |
|
|
| T |
36534704 |
ctgctcacgacagacaaaagatagaggttgga |
36534735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 713 times since January 2019
Visitors: 2236