View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0169_low_21 (Length: 271)
Name: NF0169_low_21
Description: NF0169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0169_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 49819492 - 49819710
Alignment:
Q |
1 |
acaattagaagtttctttatcctttcatgacatggtcaacaagatggcgagcaacaagaagatagtggatctgttttgacgtaccaaacaaaatagttga |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
49819492 |
acaattagaagtttctttatcctttcatgacatggtcaacaagatgtcgagcaacaagaagatagtggatctgttttgacgtaccaaacaaaatagttga |
49819591 |
T |
 |
Q |
101 |
tagagttaagattgataggtagttgagtggtgactttttactctatgagatgtttttgtgctgaagaggttggatcgttgtaagatgtggtttgatcaac |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
49819592 |
tagagttaagattgataggtagttgagtggtgactttttactctatgagatgtttttgtgctgaagaggttggatcgttgtaagatgtggtttgatcaac |
49819691 |
T |
 |
Q |
201 |
catggtggatttggtgtagg |
220 |
Q |
|
|
||||||||| |||||||||| |
|
|
T |
49819692 |
catggtgga-ttggtgtagg |
49819710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1055 times since January 2019
Visitors: 2243