View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0169_low_22 (Length: 268)
Name: NF0169_low_22
Description: NF0169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0169_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 85 - 229
Target Start/End: Complemental strand, 250395 - 250250
Alignment:
Q |
85 |
agagagaga-aagacaaggtagaagaaaggaagtcaaaatacgacagacataaatattgactagactcacgtgttgcttctcttctactggccccaccac |
183 |
Q |
|
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
250395 |
agagagagagaagacaaggtagaagaaaggaagtcaaaatacgacagacataaacattgactagactcacgcgttgcttctcttctactggccccaccac |
250296 |
T |
 |
Q |
184 |
catatatatgctttacttcacattgggtctctctcttgtgatgatg |
229 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
250295 |
catatatatgctttacttcacattgggtctctctcttgtgatgatg |
250250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 29 - 90
Target Start/End: Complemental strand, 250478 - 250419
Alignment:
Q |
29 |
cacagacagataaatcaaactacacatattcattctttctttctgagttttaagaaagagag |
90 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
250478 |
cacagacagataaatcaaactacacatattcattctttctttctgag--ttaagaaagagag |
250419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1045 times since January 2019
Visitors: 2243