View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0169_low_27 (Length: 251)
Name: NF0169_low_27
Description: NF0169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0169_low_27 |
 |  |
|
[»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 9 - 251
Target Start/End: Original strand, 38272442 - 38272685
Alignment:
Q |
9 |
agcagagagggagaaagacaggagtgataaaaggagaaaaatgaatgaatatattattgcaccgatggtttttgggacttggccattttatttagtagan |
108 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38272442 |
agcagagagggagaaagacaggagtgataaaaggagaaaaatgaatgaatatattattgcaccgatggtttttgggacttggccattttatttagtagat |
38272541 |
T |
 |
Q |
109 |
nnnnnnnnn-caacatgaaaagtttgatctaggtgggacccattgttaattatttaactcaaattcttatatgatttgtgtttgtgtgtgaatgtttgtt |
207 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38272542 |
ttttttttttcaacatgaaaagtttgatctaggtgggacccattgttaattatttaactcaaattcttatatgatttgtgtttgtgtgtgaatgtttgtt |
38272641 |
T |
 |
Q |
208 |
atcacggtgaatttgtctgaattgttgtagctttttataagatc |
251 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38272642 |
atcacggtgaatttgtctgaattgttgtagctttttataagatc |
38272685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University