View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0169_low_29 (Length: 250)
Name: NF0169_low_29
Description: NF0169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0169_low_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 9 - 241
Target Start/End: Complemental strand, 2654052 - 2653823
Alignment:
| Q |
9 |
tggtgcacagggaaccaaagaaagtactcctacctttgggatgacattagttgaagaggggcaatatgcagttgatttccatgcaaaattatcttcagta |
108 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||| | |||||||||||||||||||||||||||||||||||||||||||| |||||||||||| || |
|
|
| T |
2654052 |
tggtgcacagggaaccaaagaaattaatcctacctttagcatgacattagttgaagaggggcaatatgcagttgatttccatgccaaattatcttcatta |
2653953 |
T |
|
| Q |
109 |
caagctttctccatttgcatcgccgttttgcatggcacctctgccttcagcgctaaggcaaaacacatgaaaaatcagtagttatctcaatgcagttgtt |
208 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||| ||| ||||||| ||||||||| |||| ||||||||| |||||||||||||| ||| |
|
|
| T |
2653952 |
caagctttctccatttgcgtcgccattttgcatggcacatctaccttcagtgctaaggcagaacaggcgaaaaatcaaccgttatctcaatgca---gtt |
2653856 |
T |
|
| Q |
209 |
cattaaatacacttattgaagaagtagaattat |
241 |
Q |
| |
|
| ||||||||||||||||||||||||||||||| |
|
|
| T |
2653855 |
cgttaaatacacttattgaagaagtagaattat |
2653823 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 10 - 160
Target Start/End: Original strand, 40966325 - 40966475
Alignment:
| Q |
10 |
ggtgcacagggaaccaaagaaagtactcctacctttgggatgacattagttgaagaggggcaatatgcagttgatttccatgcaaaattatcttcagtac |
109 |
Q |
| |
|
|||||||||||| | |||||||||| |||||| || | |||| | | || |||| |||||| ||||| |||||||| ||||||||| |||| || ||| |
|
|
| T |
40966325 |
ggtgcacagggagcaaaagaaagtagtcctactttcagcatgaaaatggtcgaagcggggcattatgctgttgattttcatgcaaaactatccacattac |
40966424 |
T |
|
| Q |
110 |
aagctttctccatttgcatcgccgttttgcatggcacctctgccttcagcg |
160 |
Q |
| |
|
|||| |||||||| || | ||| |||||||||| || |||| || ||||| |
|
|
| T |
40966425 |
aagcattctccatctgtgttgccattttgcatggaacttctgtctccagcg |
40966475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 948 times since January 2019
Visitors: 2241