View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0169_low_32 (Length: 240)
Name: NF0169_low_32
Description: NF0169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0169_low_32 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 4 - 219
Target Start/End: Original strand, 43535433 - 43535648
Alignment:
Q |
4 |
cacctccgccggagtctttcaaagctttactacatggaattctacggcgaagagttgaagaggttttgtagagatggggaaaggtaggatgagagcgtgg |
103 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43535433 |
cacctccgccggagtctttcaaagctttactacatggaattctacggcgaagagttgaagaggttttgtagagatggggaaaggtaggatgagagcgtgg |
43535532 |
T |
 |
Q |
104 |
tggtgaagagagtcttcttgaattaaaatggaatttagggaatttgattggattgaagagatgagcatggttggagtttggggtttgaagtgaagggaag |
203 |
Q |
|
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43535533 |
tggagaagagagtcttcttgaattaaaatggaatttagggaatttgattggattgaagagatgagcatggttggagtttggggtttgaagtgaagggaag |
43535632 |
T |
 |
Q |
204 |
atagagaatgatgatg |
219 |
Q |
|
|
|||||||||||||||| |
|
|
T |
43535633 |
atagagaatgatgatg |
43535648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University