View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0171-INSERTION3 (Length: 192)
Name: NF0171-INSERTION3
Description: NF0171
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0171-INSERTION3 |
 |  |
|
[»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 8 - 192
Target Start/End: Complemental strand, 33945357 - 33945174
Alignment:
Q |
8 |
tttccataattaaccagaaatgttttgatttaagctaatcagatttagattaatctattaacctaaaaacgttttgcgtcttcaactatagttatagtta |
107 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33945357 |
tttccataattaaccagaaatgttttgatttaagctaatcagatttagattaatctattaacctaaaaacgttttgcgtcttcaactatagttatagtta |
33945258 |
T |
 |
Q |
108 |
attaaacgtaaagaagaaaaggaaaacccgtcactagcaaaaacaaactctttgcgggtcaaatactaattaatgttttagtata |
192 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
T |
33945257 |
attaaacgtaaagaagaaaaggaaaacccgtcactagcaaaaacaaactc-ttgcgggtcaaatactaattaatgttttattata |
33945174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 494 times since January 2019
Visitors: 2226