View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0171_low_7 (Length: 329)
Name: NF0171_low_7
Description: NF0171
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0171_low_7 |
| |
|
Alignment Details
Target: chr4 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 32 - 319
Target Start/End: Complemental strand, 24224194 - 24223907
Alignment:
Q |
32 |
aatattaataaaatttctgataataacattgtgtgtctatgagacaatatatcatttgaagctaacgtaggcaaagaagtacacgccaagaagcaaagag |
131 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
24224194 |
aatattaataaaatttctgataataacattgtgtgtctatgagacaatatatcatttgaagctaacgtaggcaaagaagtacacgccaagaagcaaagag |
24224095 |
T |
|
Q |
132 |
acaaaattttgttctcaataccatgacccagtttttcattccttataacttatatttttgtcttttaatttgtctcaagtactataggaagttgcattct |
231 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
24224094 |
acaaaattttgttctcaataccatgacccagtttttcattccttataacttatatttttgtcttttaatttgtctcaagtactataggaagttgcattct |
24223995 |
T |
|
Q |
232 |
cctttcatgccattcgtttacaataatgtaaggatgaagagcaggccttagtatgtaccccacttcacatatatataatttccctatg |
319 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
24223994 |
cctttcatgccattcgtttacaataatgtaaggatgaaaagcaggccttagtatgtaccccacttcacatatatataatttccctatg |
24223907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 11516 times since January 2019
Visitors: 1277