View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0172-INSERTION4 (Length: 340)
Name: NF0172-INSERTION4
Description: NF0172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0172-INSERTION4 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 8 - 340
Target Start/End: Complemental strand, 25930156 - 25929816
Alignment:
| Q |
8 |
gtttttatatttttcttctgggtctagctattagcagacaagcgttagttgcacttgcttatatt--------gaaggtagcaaaaccgatggttctcaa |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
25930156 |
gtttttatatttttcttctgggtctagctattagcagacaagcattagtagcacttgcttatatttaggtattgaaggtagcaaaaccgatggtgctcaa |
25930057 |
T |
 |
| Q |
100 |
ctaaacaacacagtgaaatgattgagaaaggagagaaaatgaagaatattataagtctgaatgcaacagtgatcctcagctattacaccagaatttcaga |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25930056 |
ttaaacaacacagtgaaatgattgagaaaggagagaaaatgaagaatattataagtctgaatgcaacagtgatcctcagctattacaccagaatttcaga |
25929957 |
T |
 |
| Q |
200 |
actaaaagttttacagaaaatattatctctgtcaataagaacaaacaaatcatgagatgaagtcatgccccctccatcctctctaattggtctcaccgta |
299 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
25929956 |
actaaaatttttacagaaaatattatctctgtcaataagaacaaacaaatcatgagatgaagtcatgccccctccatcctctctaattagtctcaccgta |
25929857 |
T |
 |
| Q |
300 |
cctgtaaataactgccacatcaacagtgctcttcctattat |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25929856 |
cctgtaaataactgccacatcaacagtgctcttcctattat |
25929816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University