View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0172-INSERTION8 (Length: 280)
Name: NF0172-INSERTION8
Description: NF0172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0172-INSERTION8 |
 |  |
|
[»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 8 - 280
Target Start/End: Complemental strand, 45127917 - 45127648
Alignment:
Q |
8 |
aaatatatattaattaaataacttgtttgaattgtcgagaaatcactgtcaaaattttggctccattttataagagtccagagagccttcagtggagtca |
107 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45127917 |
aaatatatattaattaaataacttgtttgaattgttgagaaatcactgtcaaaattttggctccattttataagagtccagagagccttcagtggagtca |
45127818 |
T |
 |
Q |
108 |
ctagggatcactgactactctttcccccaaagtggaaagatcctttcccattgggctttagtctttgtcaattgggctctgtgcagaactgtagatttta |
207 |
Q |
|
|
|| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45127817 |
ct----------gactactctttcccccaaagtgtaaagatcctttcccattgggctttagtctttgtcaattgggctctgtgcagaactgtagatttta |
45127728 |
T |
 |
Q |
208 |
ttctttgtttgaactttattatgtctgtattcacaaca-------acagtataacgaaagcatctattcagtaatatcta |
280 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
45127727 |
ttctttgtttgaactttattatgtctgtattcacaacaacagacaacagtataacgaaagcatctattcagtaatatcta |
45127648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 500 times since January 2019
Visitors: 2226