View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0172_low_4 (Length: 413)
Name: NF0172_low_4
Description: NF0172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0172_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 328; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 328; E-Value: 0
Query Start/End: Original strand, 27 - 402
Target Start/End: Complemental strand, 26449635 - 26449260
Alignment:
| Q |
27 |
tcagaatttacatcatcttctgcaatctaatgtggatacctacatcaaagattcaaattggaatgttcctcaagcttctttgcctgcatatcctgctttg |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||| |||||||| |
|
|
| T |
26449635 |
tcagaatttacatcatcttctgcaatctaatgtggatacctacatcaaagattcaaattggaatgttcctcaagcttttttggttgcatattctgctttg |
26449536 |
T |
 |
| Q |
127 |
cagcagaaactattgttgactactatacctattttccctaaagaagataaactaatatagaaagcctctcatgatggaaatctagcttttaaagacgcat |
226 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
26449535 |
gagcaaaaactattgatgactactatacctattgtccctaaagaagataaactaatatggaaagcctctcatgatggaaatttagcttttaaagacgcat |
26449436 |
T |
 |
| Q |
227 |
atctcttcctgacttccaatcagcctcagaacatcagttgggccaaagtcatttggcacattgctatccctccttctaagtccgtgcttgtttggagact |
326 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
26449435 |
atctcttcctgacttccaatcagcctcagaacatcagttgggccaaagtcatttggcacattgctatccctccttctaagtccttgcttgtttggagact |
26449336 |
T |
 |
| Q |
327 |
gttgcataacaagcttcctacagatgataacctctctcttagaggctttcatactacatccatttgcaatctctgt |
402 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
26449335 |
gttgcataacaagcttcctacagatgataacctctctcttagaggctgtcatactacatccatttgcaatctctgt |
26449260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University