View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0174_high_7 (Length: 238)

Name: NF0174_high_7
Description: NF0174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0174_high_7
NF0174_high_7
[»] chr8 (2 HSPs)
chr8 (1-138)||(36472192-36472329)
chr8 (5-138)||(36463042-36463175)


Alignment Details
Target: chr8 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 1 - 138
Target Start/End: Complemental strand, 36472329 - 36472192
Alignment:
1 caatggagatcaaggaataaattggagtgtgaagcagttaattctatattgttcatgtggcataattgctggaataatcggtggcttgcttggtcttggt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36472329 caatggagatcaaggaataaattggagtgtgaagcagttaattctatattgttcatgtggcataattgctggaataatcggtggcttgcttggtcttggt 36472230  T
101 ggaggatttatcttagggccacttttcattggacttgg 138  Q
    ||||||||||||||||||||||||||||||||||||||    
36472229 ggaggatttatcttagggccacttttcattggacttgg 36472192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 5 - 138
Target Start/End: Complemental strand, 36463175 - 36463042
Alignment:
5 ggagatcaaggaataaattggagtgtgaagcagttaattctatattgttcatgtggcataattgctggaataatcggtggcttgcttggtcttggtggag 104  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||  |||| |||||||| ||||||||||||||||    
36463175 ggagatcaaggaataaattggagtgtgaagcagttaattctatattgttcatgcggcataattgctggcttaattggtggcttacttggtcttggtggag 36463076  T
105 gatttatcttagggccacttttcattggacttgg 138  Q
    |||||||||||| |||||| ||| ||||||||||    
36463075 gatttatcttagcgccactcttccttggacttgg 36463042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1064 times since January 2019
Visitors: 1523