View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0174_high_7 (Length: 238)
Name: NF0174_high_7
Description: NF0174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0174_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 1 - 138
Target Start/End: Complemental strand, 36472329 - 36472192
Alignment:
| Q |
1 |
caatggagatcaaggaataaattggagtgtgaagcagttaattctatattgttcatgtggcataattgctggaataatcggtggcttgcttggtcttggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36472329 |
caatggagatcaaggaataaattggagtgtgaagcagttaattctatattgttcatgtggcataattgctggaataatcggtggcttgcttggtcttggt |
36472230 |
T |
 |
| Q |
101 |
ggaggatttatcttagggccacttttcattggacttgg |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36472229 |
ggaggatttatcttagggccacttttcattggacttgg |
36472192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 5 - 138
Target Start/End: Complemental strand, 36463175 - 36463042
Alignment:
| Q |
5 |
ggagatcaaggaataaattggagtgtgaagcagttaattctatattgttcatgtggcataattgctggaataatcggtggcttgcttggtcttggtggag |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||| |||||||| |||||||||||||||| |
|
|
| T |
36463175 |
ggagatcaaggaataaattggagtgtgaagcagttaattctatattgttcatgcggcataattgctggcttaattggtggcttacttggtcttggtggag |
36463076 |
T |
 |
| Q |
105 |
gatttatcttagggccacttttcattggacttgg |
138 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||| |
|
|
| T |
36463075 |
gatttatcttagcgccactcttccttggacttgg |
36463042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University