View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0174_high_8 (Length: 233)

Name: NF0174_high_8
Description: NF0174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0174_high_8
NF0174_high_8
[»] chr1 (1 HSPs)
chr1 (15-233)||(51011774-51011990)


Alignment Details
Target: chr1 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 15 - 233
Target Start/End: Original strand, 51011774 - 51011990
Alignment:
15 atacataaagagtgaatagagaaatggatggagatgatccaagttcgttattgttacaagataacaatttttatgtgccatttaaatccatgtctctttc 114  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
51011774 atacataaagagtgaatagagaaatggatggagatgatccaaattcgttattgttacaagataacaatttttatgtggcatttaaatccatgtctctttc 51011873  T
115 ttttcnnnnnnnccccctgtatatcccaaaaagtagagagactaatatgcaatttatggaaaagggaccgatatagaactttttaaaatgcagcgagagt 214  Q
    |||||        ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51011874 ttttctttttt--cccctttatatcccaaaaagtagagagactaatatgcaatttatggaaaagggaccgatatagaactttttaaaatgcagcgagagt 51011971  T
215 tttctttaaatagaccact 233  Q
    |||||||||||||||||||    
51011972 tttctttaaatagaccact 51011990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University