View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0174_low_13 (Length: 233)
Name: NF0174_low_13
Description: NF0174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0174_low_13 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 15 - 233
Target Start/End: Original strand, 51011774 - 51011990
Alignment:
| Q |
15 |
atacataaagagtgaatagagaaatggatggagatgatccaagttcgttattgttacaagataacaatttttatgtgccatttaaatccatgtctctttc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
51011774 |
atacataaagagtgaatagagaaatggatggagatgatccaaattcgttattgttacaagataacaatttttatgtggcatttaaatccatgtctctttc |
51011873 |
T |
 |
| Q |
115 |
ttttcnnnnnnnccccctgtatatcccaaaaagtagagagactaatatgcaatttatggaaaagggaccgatatagaactttttaaaatgcagcgagagt |
214 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51011874 |
ttttctttttt--cccctttatatcccaaaaagtagagagactaatatgcaatttatggaaaagggaccgatatagaactttttaaaatgcagcgagagt |
51011971 |
T |
 |
| Q |
215 |
tttctttaaatagaccact |
233 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
51011972 |
tttctttaaatagaccact |
51011990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University