View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0174_low_15 (Length: 205)
Name: NF0174_low_15
Description: NF0174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0174_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 112; Significance: 8e-57; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 112; E-Value: 8e-57
Query Start/End: Original strand, 30 - 187
Target Start/End: Complemental strand, 42291489 - 42291344
Alignment:
| Q |
30 |
agaattactactatacgatatagtccaactaattatagaaacatggatcggttttggaattggtattatgatgatttcaaatgatcgctttttattgtga |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42291489 |
agaattactactatacgatatagtccaactaattatagaaacatggatcggttttggaattggtattatgatgatttcaaatgatcgctttttattgtga |
42291390 |
T |
 |
| Q |
130 |
tcattggagtaactaattaataacattttatggaaacttcttgttttgcacctttgat |
187 |
Q |
| |
|
||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42291389 |
tca-tggag-----------taacattttatggaaacttcttgttttgcacctttgat |
42291344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University