View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0174_low_2 (Length: 404)
Name: NF0174_low_2
Description: NF0174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0174_low_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 2e-87; HSPs: 6)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 2e-87
Query Start/End: Original strand, 105 - 276
Target Start/End: Complemental strand, 51012576 - 51012405
Alignment:
| Q |
105 |
tagtttagcttgaaactatgatcatgagcagatgatgaataaaataataattaccgattggttattccatgaagcaattttaatcgagctttttaaaact |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51012576 |
tagtttagcttgaaactatgatcatgagcagatgatgaataaaataataattaccgattggttattccatgaagcaattttaatcgagctttttaaaact |
51012477 |
T |
|
| Q |
205 |
gatgctcaaatcatacacaatatcaagcttttctttgttctttcttgaatataaataaacacacattctttc |
276 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
51012476 |
gatgctcaaatcatactcaatatcaagcttttctttgttctttcttgaatatgaataaacacacattctttc |
51012405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 161 - 220
Target Start/End: Original strand, 28761047 - 28761106
Alignment:
| Q |
161 |
attggttattccatgaagcaattttaatcgagctttttaaaactgatgctcaaatcatac |
220 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
28761047 |
attggttattccatgaagctatcctaatcgagctttttaaaactgatgctcaaatcatac |
28761106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 129 - 220
Target Start/End: Original strand, 28762330 - 28762423
Alignment:
| Q |
129 |
tgagcagatgatgaa-taaaata-ataattaccgattggttattccatgaagcaattttaatcgagctttttaaaactgatgctcaaatcatac |
220 |
Q |
| |
|
||||||||||||||| |||||| |||||| | ||||||||||||||||||| ||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
28762330 |
tgagcagatgatgaaataaaatcgataattgcttattggttattccatgaagctattctaatcgagctttttaaagttgatgctcaaatcatac |
28762423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 161 - 221
Target Start/End: Original strand, 28760884 - 28760944
Alignment:
| Q |
161 |
attggttattccatgaagcaattttaatcgagctttttaaaactgatgctcaaatcataca |
221 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
28760884 |
attggttattccatgaagctatgctaatcgagctttttaaaactgatgctcaaaccataca |
28760944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 161 - 220
Target Start/End: Original strand, 28761689 - 28761748
Alignment:
| Q |
161 |
attggttattccatgaagcaattttaatcgagctttttaaaactgatgctcaaatcatac |
220 |
Q |
| |
|
||||||||||||||||||| || |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
28761689 |
attggttattccatgaagctatcctaattgagctttttaaaactgatgctcaaatcatac |
28761748 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 352 - 388
Target Start/End: Complemental strand, 51012299 - 51012263
Alignment:
| Q |
352 |
atgttcgtgttatattcaaattcaatagttttgtaga |
388 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||| |
|
|
| T |
51012299 |
atgttcgtgttatatttagattcaatagttttgtaga |
51012263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1038 times since January 2019
Visitors: 1522