View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0174_low_4 (Length: 367)
Name: NF0174_low_4
Description: NF0174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0174_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 99; Significance: 9e-49; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 99; E-Value: 9e-49
Query Start/End: Original strand, 1 - 166
Target Start/End: Complemental strand, 27789229 - 27789066
Alignment:
| Q |
1 |
cttcaaaattcgtgttcaggtcggaaaaggaaactgatctaaggttccttcgtataatctctctcatgtaannnnnnnnncttctggcgtagatttactt |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| ||||||||| |||||||| |||| |||||||| |||||||||||| |||||| |
|
|
| T |
27789229 |
cttcaaaatttgtgttcaggtcggaaaaggaaactgatataaggttccctcgtataaactctatcatgtaatttttttt--ttctggcgtagagttactt |
27789132 |
T |
|
| Q |
101 |
gcttctttctttttccggcgagttgagatcagtgtgaatcaatctaacttgtttatgacgcagcaa |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
27789131 |
gcttctttctttttccggcgagttgagatcagtgtgaatcaatccaacttgttaatgacgcagcaa |
27789066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 262 - 339
Target Start/End: Complemental strand, 27788980 - 27788903
Alignment:
| Q |
262 |
agtgaattatggacctcttcaaagagatgtagcttgggcttggattagatcacaatctcatgggagaattgctcttat |
339 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27788980 |
agtgaattatggacctcttcaaagagatgtagattgggcttggattagatcacaatctcatgggagaattgcacttat |
27788903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 979 times since January 2019
Visitors: 1519