View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0174_low_6 (Length: 315)
Name: NF0174_low_6
Description: NF0174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0174_low_6 |
 |  |
|
| [»] scaffold0059 (3 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 152; Significance: 2e-80; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 29 - 212
Target Start/End: Original strand, 1954813 - 1954996
Alignment:
| Q |
29 |
gagcagagggactacctcatgatggatcaacatgctgcaattttccgcagtaactagagaatctaccatcatatctatgatgctctcttggtttcgctaa |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1954813 |
gagcagagggactacctcatgatggatcaacatgctgcaattttccgcagtaaccagagaatctaccatcatatctatgatgctctcttggtttcgctaa |
1954912 |
T |
 |
| Q |
129 |
ctcctgaccagtttctgcggtctcgcatgtggcctagggacataacaatttactttggagggggtgctgcatacggtggcacta |
212 |
Q |
| |
|
|||||||||| ||||||| |||| |||||||||||||||||| ||||||||||| ||||||||||| | ||||||||||||||| |
|
|
| T |
1954913 |
ctcctgaccaatttctgcagtcttgcatgtggcctagggacagaacaatttactctggagggggtggtacatacggtggcacta |
1954996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0059 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 3)
Name: scaffold0059
Description:
Target: scaffold0059; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 23 - 113
Target Start/End: Complemental strand, 15358 - 15268
Alignment:
| Q |
23 |
agacaggagcagagggactacctcatgatggatcaacatgctgcaattttccgcagtaactagagaatctaccatcatatctatgatgctc |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | ||||| || |||| || |||||| || | |||||||| ||| |||||||||||| |
|
|
| T |
15358 |
agacaggagcagagggactacctcatgatggattagcatgcagccgttttacgaagtaaccagggcatctaccaacatctctatgatgctc |
15268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0059; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 23 - 113
Target Start/End: Complemental strand, 14111 - 14021
Alignment:
| Q |
23 |
agacaggagcagagggactacctcatgatggatcaacatgctgcaattttccgcagtaactagagaatctaccatcatatctatgatgctc |
113 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||||| ||| ||||||| |||||| | | |||| ||| ||| |||||||||||| |
|
|
| T |
14111 |
agacaggagcagagggactatctcatgatggaacaacatgtggcagttttccgaagtaaccaaggcatcttccaacatctctatgatgctc |
14021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0059; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 148 - 212
Target Start/End: Complemental strand, 15221 - 15157
Alignment:
| Q |
148 |
gtctcgcatgtggcctagggacataacaatttactttggagggggtgctgcatacggtggcacta |
212 |
Q |
| |
|
|||| ||||||||||| ||||||| || |||||| ||||||||||| |||| |||||||||||| |
|
|
| T |
15221 |
gtcttgcatgtggcctggggacatgccagtttactctggagggggtggtgcacacggtggcacta |
15157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University