View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0174_low_8 (Length: 278)
Name: NF0174_low_8
Description: NF0174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0174_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 21 - 228
Target Start/End: Original strand, 3364309 - 3364516
Alignment:
Q |
21 |
agcagagataaaagatcataacatattttgatttgttttttgtgatacctcaaagaaaaacatggagtggccagcatgtacggatgaatatgaaaagctc |
120 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3364309 |
agcagagataaaagatcataacatattttgatttgttttttgtgatacctcaaagaaaaacatggagtggccagcatgtacggatgaatatgaaaagctc |
3364408 |
T |
 |
Q |
121 |
ttgataaggatgagcacacccaggtttgttaatattccttcatcatgtagtttatatgttttggattgatcttaaatagtctatgtgattttatgaattt |
220 |
Q |
|
|
|||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
3364409 |
ttgataaggatgagcacacctaggtttgttaattttccttcatcatgtagtttatatgttttggattgatcttaaatagtctatgtggttttatgaattt |
3364508 |
T |
 |
Q |
221 |
ctacatga |
228 |
Q |
|
|
|||||||| |
|
|
T |
3364509 |
ctacatga |
3364516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University