View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0174_low_9 (Length: 262)
Name: NF0174_low_9
Description: NF0174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0174_low_9 |
 |  |
|
[»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 27 - 262
Target Start/End: Original strand, 3364219 - 3364454
Alignment:
Q |
27 |
gagcagagacagaaagaaagtattggacacccagatcacacaacataggtgacatagtttgagttggttaaggttgtttgaggaagttcaagcagagata |
126 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3364219 |
gagcatagacagaaagaaagtattggacacccagatcacacaacataggtgacatagtttgagttggttaaggttgtttgaggaagttcaagcagagata |
3364318 |
T |
 |
Q |
127 |
aaagatcataacatattttgatttggtttttgtgatacctcaaagaaaaacatggagtggccagcatgtacggatgaatatgaaaagctcttgataagga |
226 |
Q |
|
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3364319 |
aaagatcataacatattttgatttgttttttgtgatacctcaaagaaaaacatggagtggccagcatgtacggatgaatatgaaaagctcttgataagga |
3364418 |
T |
 |
Q |
227 |
tgagcacacccaggtttgttaatattccttcatcat |
262 |
Q |
|
|
|||||||||| |||||||||||| |||||||||||| |
|
|
T |
3364419 |
tgagcacacctaggtttgttaattttccttcatcat |
3364454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1046 times since January 2019
Visitors: 1522