View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0175-Insertion-17 (Length: 155)
Name: NF0175-Insertion-17
Description: NF0175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0175-Insertion-17 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 137; Significance: 7e-72; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 137; E-Value: 7e-72
Query Start/End: Original strand, 11 - 155
Target Start/End: Complemental strand, 47285628 - 47285484
Alignment:
| Q |
11 |
tctgcatgaaggataggtctgtagctgcttgagttgttgttatggttataattagtgtgaagcaaaagaaaacatagacagtggtagagaatttgaagtg |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47285628 |
tctggatgaaggataggtctgtagctgcttgagttgttattatggttataattagtgtgaagcaaaagaaaacatagacagtggtagagaatttgaagtg |
47285529 |
T |
 |
| Q |
111 |
gtgcagcatttgtttttgatggatcatgttttttgctcttgatgt |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47285528 |
gtgcagcatttgtttttgatggatcatgttttttgctcttgatgt |
47285484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University