View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0175-Insertion-19 (Length: 279)
Name: NF0175-Insertion-19
Description: NF0175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0175-Insertion-19 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 51 - 279
Target Start/End: Complemental strand, 3685214 - 3684980
Alignment:
| Q |
51 |
acgattggatttaatttgagatagaaatcaacaccgaacaaatgcttggatgaaagctattggatccaattgtaaatgtagtaagctactagatccaaaa |
150 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3685214 |
acgattggatttgacttgagatagaaatcaacaccgaacaaatgcatggatgaaagctattggatccaattgtaaatgtagtaagctactagatccaaaa |
3685115 |
T |
|
| Q |
151 |
ttggatacaaaacgtaattcaagtgacgctcatgctatgaaccctaattgagcgtctcagaactttgtattcttaaaattattatttttattaagat--- |
247 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3685114 |
ttggatacaaaacgtaattcaagtgaagctcatgctatgaaccctagttgagcgtctcagaactttgtattcttaaaattattatttttattaagataca |
3685015 |
T |
|
| Q |
248 |
---aaaagagcataaaaaacaattgaagacaaaac |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
3685014 |
agcaaaagagcataaaaaacaattgaagacaaaac |
3684980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 7 - 54
Target Start/End: Complemental strand, 3685310 - 3685263
Alignment:
| Q |
7 |
acgtctttcacgtgttaaacctttgtatacaatgaatttcacaaacga |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3685310 |
acgtctttcacgtgttaaacctttgtatacaatgaatttcacaaacga |
3685263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 671 times since January 2019
Visitors: 2235