View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0175_low_5 (Length: 232)
Name: NF0175_low_5
Description: NF0175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0175_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 106 - 152
Target Start/End: Complemental strand, 33537868 - 33537822
Alignment:
| Q |
106 |
tagttgtaaattgaagtgacaacaccatgtaagataagatgatgatg |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33537868 |
tagttgtaaattgaagtgacaacaccatgtaagataagatgatgatg |
33537822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 589 times since January 2019
Visitors: 2233