View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0176_high_1 (Length: 259)

Name: NF0176_high_1
Description: NF0176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0176_high_1
NF0176_high_1
[»] chr7 (2 HSPs)
chr7 (150-252)||(42724070-42724172)
chr7 (38-123)||(42723958-42724043)


Alignment Details
Target: chr7 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 150 - 252
Target Start/End: Original strand, 42724070 - 42724172
Alignment:
150 gatgatgcttctgttgtttttagtttcattattgattctaaaaccacatcatcttctatttcagcttcttctgcatcttgttgagttctttgttgttgtt 249  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42724070 gatgatgcttctgttgtttttagtttcattattgattctaaaaccacatcatcttctatttcagcttcttctgcatcttgttgagttctttgttgttgtt 42724169  T
250 gat 252  Q
    |||    
42724170 gat 42724172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 38 - 123
Target Start/End: Original strand, 42723958 - 42724043
Alignment:
38 gaaatatctctcagcatgttgttttggaataacgagtcggttcaacttccctacatcgcttggtgttaatggtttctcaaacatcg 123  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42723958 gaaatatctctcagcatgttgttttggaataacgagtcggttcaacttccctacatcgcttggtgttaatggtttctcaaacatcg 42724043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University