View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0176_high_1 (Length: 259)
Name: NF0176_high_1
Description: NF0176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0176_high_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 150 - 252
Target Start/End: Original strand, 42724070 - 42724172
Alignment:
| Q |
150 |
gatgatgcttctgttgtttttagtttcattattgattctaaaaccacatcatcttctatttcagcttcttctgcatcttgttgagttctttgttgttgtt |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42724070 |
gatgatgcttctgttgtttttagtttcattattgattctaaaaccacatcatcttctatttcagcttcttctgcatcttgttgagttctttgttgttgtt |
42724169 |
T |
 |
| Q |
250 |
gat |
252 |
Q |
| |
|
||| |
|
|
| T |
42724170 |
gat |
42724172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 38 - 123
Target Start/End: Original strand, 42723958 - 42724043
Alignment:
| Q |
38 |
gaaatatctctcagcatgttgttttggaataacgagtcggttcaacttccctacatcgcttggtgttaatggtttctcaaacatcg |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42723958 |
gaaatatctctcagcatgttgttttggaataacgagtcggttcaacttccctacatcgcttggtgttaatggtttctcaaacatcg |
42724043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University