View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0176_low_1 (Length: 306)
Name: NF0176_low_1
Description: NF0176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0176_low_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 11 - 277
Target Start/End: Original strand, 50117801 - 50118062
Alignment:
| Q |
11 |
gatgaaagccaaagcctggatttaattcatctcagatggcgtacgttcagggttgagttcaaccctaaagaggtatgttatccgtcgatccagaaaactt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50117801 |
gatgaaagccaaagcctggatttaattcatctcagatggcgtacgttca------------accctaaagaggtatgttatccgtcgatccagaaaactg |
50117888 |
T |
|
| Q |
111 |
attttgtttgttggtttcaataccgaaacgcgctaata--------ttatgtggggttatgagtttttgaaaatgttatctgcaaatgacttctccatgt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50117889 |
attttgtttgttggtttcaataccgaaacccgctactaatattatgttatgtggggttatgagtttttgaaaatgttatctgcaaatgacttctccatgt |
50117988 |
T |
|
| Q |
203 |
taatgttaagttaatgtatccgtaagttgtagccaattttataccgtaacattataactgttttgtaccagtcta |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
50117989 |
taatgttaagttaatgtatccgtaagttgtagccaattttataccgtaacattataactg-tttgtaccagtcta |
50118062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 653 times since January 2019
Visitors: 2235