View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0177_low_12 (Length: 251)
Name: NF0177_low_12
Description: NF0177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0177_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 171831 - 171609
Alignment:
Q |
1 |
ctctggattcaaaggtggtggctatgtcgttaaacagtcgacaatgtagcatgatatagattggtaaagcgtattatcaggcttttggaaatgaattgtt |
100 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
171831 |
ctctggattcaaaggtggttgctatgtcgttaaacagtcgacaatgttgcatgatatagattggtaaagcgtattatcaggcttttggaaatgaattgtt |
171732 |
T |
 |
Q |
101 |
gtgcaaatactttggctaatgaaggatgtaatgggggcttgtcttcaattatttatgagat--------atcaatctaggcatttgttattcactgatgt |
192 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
171731 |
gtgcaaatactttggctaatgaaggatgtaatgggggattgtcttcaattatttatgagatatgtctggatcaatctaggcatttgttattca------- |
171639 |
T |
 |
Q |
193 |
ctgatggtatggaagttgtggaaccgaacc |
222 |
Q |
|
|
|||||||||||||||||||||||||||||| |
|
|
T |
171638 |
ctgatggtatggaagttgtggaaccgaacc |
171609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University