View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0177_low_9 (Length: 285)
Name: NF0177_low_9
Description: NF0177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0177_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 252
Target Start/End: Original strand, 30842404 - 30842655
Alignment:
| Q |
1 |
ttctatttgatgatttcattctcaaagcttctaattgcatttcgagttctaataagtcccgtgatgctgcttcttcttcttcttccaagaattttgtttc |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30842404 |
ttctgtttgatgatttcattctcaaagcttctaattgcatttcgagttctaataagtcccgtgatgctgcttcttcttcttcttccaagaattttgtttc |
30842503 |
T |
|
| Q |
101 |
ttcttcgaatttattcgataaagaaggtgtcgagattaaggagaagaagggttcaaagttagcattatttaccaaggatgacagttatttggtgaataat |
200 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
30842504 |
ttcttcgagtttattcgataaagaaggtgtcgagattaaggagaagaagggttcaaagttagcattatttactaaggatgacagttatttggtgaataat |
30842603 |
T |
|
| Q |
201 |
aaggctatgtctacattcaagtttaatactgattcttatgcaattggacaca |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30842604 |
aaggctatgtctacattcaagtttaatactgatgcttatgcaattggacaca |
30842655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 860 times since January 2019
Visitors: 2241