View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0178-INSERTION-3 (Length: 276)
Name: NF0178-INSERTION-3
Description: NF0178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0178-INSERTION-3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 8 - 262
Target Start/End: Original strand, 49602774 - 49603028
Alignment:
| Q |
8 |
ccaattccctcttcttctcagcaaaccctttccactctcccatattcttcatctccactttcttcccttccccgatcaccttaccttcaagctcacctgc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49602774 |
ccaattccctcttcttctcagcaaaccctttccactctcccaaattcttcatctccactttcttcccttccccgatcaccttaccttcaagctcacctgc |
49602873 |
T |
 |
| Q |
108 |
atcctcaaaccaaacacccaattcacttgctttcatcaatggaagctttggaagattcttgaacttgttgtaatacccttttcccttattagcatcgttg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49602874 |
atcctcaaaccaaacacccaattcacttgctttcatcaatggaagctttggaagattcttgaacttgttgtaatacccttttcccttattagcatcgttg |
49602973 |
T |
 |
| Q |
208 |
tccaatgacagaacaggtggtttcggtttaggttctggttttttcgatttggaat |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49602974 |
tccaatgacagaacaggtggtttcggtttaggttctggttttttcgatttggaat |
49603028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 8 - 262
Target Start/End: Complemental strand, 7226421 - 7226167
Alignment:
| Q |
8 |
ccaattccctcttcttctcagcaaaccctttccactctcccatattcttcatctccactttcttcccttccccgatcaccttaccttcaagctcacctgc |
107 |
Q |
| |
|
||||| |||||||||||||| |||| ||||||||||| |||| ||| |||| |||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7226421 |
ccaataccctcttcttctcaacaaaacctttccactcacccaaatttttcacgtccactttcttcccttccccaatcaccttaccttcaagctcacctgc |
7226322 |
T |
 |
| Q |
108 |
atcctcaaaccaaacacccaattcacttgctttcatcaatggaagctttggaagattcttgaacttgttgtaatacccttttcccttattagcatcgttg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
7226321 |
atcctcaaaccaaacacccaattcacttgctttcatcaatggaagctttggaagattcttgaacttgttgtagtaccctttttccttattagcatcgttg |
7226222 |
T |
 |
| Q |
208 |
tccaatgacagaacaggtggtttcggtttaggttctggttttttcgatttggaat |
262 |
Q |
| |
|
| |||||||| |||||| ||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
7226221 |
ttcaatgacaaaacagggggtttcggtttaggttctggttttttcaatttcgaat |
7226167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University