View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0178_low_2 (Length: 457)
Name: NF0178_low_2
Description: NF0178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0178_low_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 342; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 342; E-Value: 0
Query Start/End: Original strand, 11 - 360
Target Start/End: Original strand, 36068047 - 36068396
Alignment:
| Q |
11 |
cacagattagtgttaacatcaatttacttgaaataaatgaaacaactatctcatagagtgcaaaatgttaaaaatttaaacctattggttgttcgaaaaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
36068047 |
cacagattagtgttaacatcaatttacttgaaataaatgaaacaactatctcatagagtgcaaaatgttaaaaatttaaacctattggttgttcgaaata |
36068146 |
T |
|
| Q |
111 |
tggataaggatcatatctaacaacacaacttggatagaaaacacttcctctaatctttcctttagcacacgaggtttgcagataatttatagcatcattt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36068147 |
tggataaggatcatatctaacaacacaacttggatataaaacacttcctctaatctttcctttagcacacgaggtttgcagataatttatagcatcattt |
36068246 |
T |
|
| Q |
211 |
aaacacttcatgcaattatcattagagagatttggtatgcattgagcaaggccatacaagaatttgtcctcaaagaaaattgctctcttgagaacaaatt |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36068247 |
aaacacttcatgcaattatcattagagagatttggtatgcattgagcaaggccatacaagaatttgtcctcaaagaaaattgctctcttgagaacaaatt |
36068346 |
T |
|
| Q |
311 |
tgatagaatttcccgttgaagttttaatagcttgagttacaggcttcttc |
360 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36068347 |
tgatagaatttcccgttgaagttttaatagcttgagttacaggcttcttc |
36068396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 943 times since January 2019
Visitors: 1518