View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0178_low_7 (Length: 232)
Name: NF0178_low_7
Description: NF0178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0178_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 51753871 - 51754094
Alignment:
| Q |
1 |
caagctatcaggtacaactatttgtggaattaatctaagcttagtagttttggaagctattacaagatatttgcattttcatcaagtaccattacaaagt |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51753871 |
caagctatcaggtacaactatttttggaattaatctaagcttagtagttttggaagctattacaagatatttgcattttcatcaagtaccattacaaagt |
51753970 |
T |
|
| Q |
101 |
gcttgttccatgccttg-aacaaagcaaaagtgaaaaattgaagataggtcttccaagattacataccatgctctcggataccatgtgcaaaaccatcat |
199 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51753971 |
gcttgttccatgccttgaaactaagcaaaagtgaaaaattgaagataggtcttccaagattacataccatgctctcggataccatgtgcaaaaccatcat |
51754070 |
T |
|
| Q |
200 |
cttttcttccaaacatgttcatct |
223 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
51754071 |
cttttcttccaaacatgttcatct |
51754094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 122 - 223
Target Start/End: Complemental strand, 5522949 - 5522848
Alignment:
| Q |
122 |
aagcaaaagtgaaaaattgaagataggtcttccaagattacataccatgctctcggataccatgtgcaaaaccatcatcttttcttccaaacatgttcat |
221 |
Q |
| |
|
||||||| |||||| ||||||||| |||| ||||||||||||||||||| ||| ||||||||||||| ||| | |||||||||||||||||||| |
|
|
| T |
5522949 |
aagcaaaggtgaaacattgaagattaatctttggagattacataccatgctcttggactccatgtgcaaaactgtcaccctttcttccaaacatgttcat |
5522850 |
T |
|
| Q |
222 |
ct |
223 |
Q |
| |
|
|| |
|
|
| T |
5522849 |
ct |
5522848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 949 times since January 2019
Visitors: 1518