View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0179_high_6 (Length: 248)

Name: NF0179_high_6
Description: NF0179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0179_high_6
NF0179_high_6
[»] chr5 (2 HSPs)
chr5 (165-248)||(27131701-27131784)
chr5 (28-67)||(27131383-27131422)


Alignment Details
Target: chr5 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 165 - 248
Target Start/End: Original strand, 27131701 - 27131784
Alignment:
165 tcgaggaatagttggacccattgtataagtaatatgaaataacaaaacaaaatttaaactaattattttatgcatgtgagactc 248  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
27131701 tcgaggaatagttggacccattgtataagtaatataaaataacaaaacaaaatttaaactaattattttatgcatgtgagactc 27131784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 67
Target Start/End: Original strand, 27131383 - 27131422
Alignment:
28 actattgtctactactattagtcttctttgttaatcacac 67  Q
    |||| |||||||||||||||||||||||||||||||||||    
27131383 actactgtctactactattagtcttctttgttaatcacac 27131422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University